gcvH [2019-02-19 19:22:13]

glycine cleavage system protein H, lipoyl-binding site, octanoyltransferase for lipoic acid biosynthesis, required for lipoate transfer to 2-oxo acid dehydrogenases

Locus: BSU32800

Isoelectric point: 3.89

Molecular weight: 14.11 kDa

Protein length: 127 aa

Gene length: 384 bp

Function: glycine utilization

Product: glycine cleavage system protein H

Essential: no

Synonyms: yusH

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of threonine/ glycine
• Metabolism → Additional metabolic pathways → Biosynthesis of cofactors → Biosynthesis and scavenging of lipoic acid

Gene

Coordinates: 3,366,123 3,366,506

The protein

Catalyzed reaction/ biological activity

• degradation of glycine. GcvH shuttles the methylamine group of glycine from GcvPB to GcvT (according to UniProt)
• assembly of lipoate, and transfer of the cofactor to PdhC, OdhB, AcoC, and BkdB

Protein family

• gcvH family (according to Swiss-Prot)

Cofactors

• lipoic acid (on Lys-63), lipoylated by LipM PubMed, can probably be removed by SrtN PubMed

Structure

• 3IFT (from Mycobacterium tuberculosis, 50% identity) PubMed

Expression and Regulation

Operons

• Genes: yusI-gcvH-yusG
  Description: PubMed

• Genes: gcvH-yusG
  Description: PubMed

Biological materials

Mutant

• MGNA-B592 (yusH::erm), available at the NBRP B. subtilis, Japan
• BKE32800 (gcvH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTGAATCCCTCCATTTT, downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
• BKK32800 (gcvH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTGAATCCCTCCATTTT, downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
• GP2585 (gcvH::tet comIQ12L) (in DK1042) available at Jrg Stlke's lab

References

Reviews

Loading

Original publications

Loading